rs9422545 chr10:43575306 A>G
- Sequence
tcaccgagtgacacagagctaccc[A/G]tttggtcttttcccaattcctttc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.26 | 0.44 | 1.35 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, hdl cholesterol, hdl cholesterol change with statins, irritible bowel syndrome, systolic blood pressure (sbp), type 2 diabetes
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Testis