rs9425316 chr1:172431720 C>T
- Sequence
catttccaactgaggtatctggtt[C/T]atctcactgggcctggttggacag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) breast tumor tissue
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.64 | 0.02 | 2.04 | |||
| breast tumor tissue | 1.43 | 0.22 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood