rs9430018 chr1:209823197 T>G
- Sequence
acacagtaactgcttagaaaatgc[T/G]tgataaaatgaatgaatgtatgaa
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.45 | 1.03 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, homa-b, ldl cholesterol, obesity with early age of onset (age >2), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Whole_Blood