rs9442836 chr6:72703411 G>T
- Sequence
ctgaattactgcacttctatggct[G/T]gtttgtttgttttgtttttgtttt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NCOR1_HUMAN | 2.30 | -3.18 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1