rs9444046 chr6:83215370 T>C
- Sequence
gaggccaggaatgctgctgaagat[T/C]gtacaatgcctgggacagccgcat
- ASB in cell types
- B-cells LNCaP clone FGC epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| B-cells | 2.13 | n/a | 2.00 | |||
| LNCaP clone FGC | 1.55 | -0.35 | 1.42 | |||
| epidermal keratinocytes | 1.25 | 0.16 | 2.00 |
Items per page:
1 – 3 of 3