rs9449868 chr6:84350569 G>A
- Sequence
gagtttaaatatgctctgatgaca[G/A]ctggcttacttgtgtgagctgttg
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PRDM4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM4_HUMAN | 2.21 | n/a | 2.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP late onset alzheimers disease, obesity with early age of onset (age >2), sporadic creutzfeldt-jakob disease