rs9452 chr16:12573932 G>T
- Sequence
ctgacaccgacttcttagagaagc[G/T]agtcttttttgaatggaggagcga
- ASB in cell types
- HepG2 (hepatoblastoma) erythroid cells GM12878 (female B-cells) thyroid gland
- ASB for transcription factors
- ZBT26_HUMAN FOXA2_HUMAN ZN143_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT26_HUMAN | 2.22 | n/a | 3.00 | n/a | n/a | |||
| FOXA2_HUMAN | 2.90 | n/a | 3.00 | n/a | No Hit | |||
| ZN143_HUMAN | -1.53 | 1.60 | 1.00 | n/a | No Hit | |||
| RAD21_HUMAN | 1.99 | 0.43 | 2.46 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, hip bone mineral density (bmd), longstanding arthritis, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood