rs945291 chr10:26456116 A>G
- Sequence
gggagaggaggagtgaacggatac[A/G]gggtttcttttataggagaagaaa
- ASB in cell types
- monocyte-derived macrophages GM12878 (female B-cells)
- ASB for transcription factors
- SPI1_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.68 | 0.38 | 2.05 | n/a | No Hit | |||
| IKZF1_HUMAN | -0.53 | 1.33 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood