rs9456201 chr6:168568611 G>A
- Sequence
actgccctgaaaacctagagtgac[G/A]tgtacccaccatcatggtatcata
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.94 | n/a | 2.00 | -4.45 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, barnes akathisia rating scale, triglycerides change with statins