rs9457258 chr6:167030766 T>C
- Sequence
tttcattgttgcctcctgtacaca[T/C]atttcttctggcggtggtacgatt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ARI1B_HUMAN HTF4_HUMAN NFIC_HUMAN RING2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | 2.98 | n/a | 1.33 | n/a | n/a | |||
| HTF4_HUMAN | 2.44 | -1.04 | 1.33 | n/a | No Hit | |||
| NFIC_HUMAN | 2.29 | -2.20 | 1.33 | n/a | No Hit | |||
| RING2_HUMAN | 2.21 | -2.11 | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | 1.92 | -1.60 | 1.33 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Vagina, Whole_Blood