rs9463882 chr6:53233413 T>A
- Sequence
ctccggcaccccagcctgaagtta[T/A]tattaaagttcagtttaactcttg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.14 | 0.75 | 2.44 |
Items per page:
1 – 1 of 1