rs9464973 chr6:16974390 T>C
- Sequence
cttccaagcttaccttggcaacag[T/C]tcttttccctgttctcttttgaaa
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 0.61 | 0.74 | 1.10 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, coronary artery disease (cad), cystatin c in serum, hdl cholesterol, height, ldl cholesterol, total cholesterol, years of education