rs9473622 chr6:49607281 A>G
- Sequence
tggatctcagccaaagaaagtctc[A/G]ctcactgagggtgtggatgactgc
- ASB in cell types
- epidermal keratinocytes MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 1.79 | -1.48 | 2.00 | |||
| MM1.S (plasma cell myeloma) | -0.44 | 1.13 | 1.37 |
Items per page:
1 – 2 of 2