rs9484448 chr6:140897923 C>T
- Sequence
taattactgtccgataaagctaaa[C/T]cctttggccaggaaaggggaaggc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- RING2_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RING2_HUMAN | n/a | 1.91 | 1.33 | n/a | n/a | |||
| HDAC1_HUMAN | n/a | 1.12 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, attention-deficit/hyperactivity disorder (adhd), college completion, hdl cholesterol, hypertension (early onset hypertension), tourettes syndrome
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Hypothalamus, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Heart_Left_Ventricle, Nerve_Tibial, Pancreas, Pituitary, Spleen, Testis, Thyroid, Whole_Blood