rs9488923 chr6:116409912 G>A
- Sequence
actgttcaagcacaagtagctgct[G/A]tacaaaggcctggagataaaagaa
- ASB in cell types
- periferal blood macrophages CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN HTF4_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.86 | 0.00 | 2.11 | n/a | No Hit | |||
| HTF4_HUMAN | 1.89 | n/a | 1.33 | n/a | No Hit | |||
| SPI1_HUMAN | 1.28 | 0.02 | 1.85 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), height, ldl cholesterol, obesity with early age of onset (age >2), prostate cancer, serum creatinine, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood