rs9512144 chr13:26184942 C>T
- Sequence
gtctacctagtgagctccaaagtg[C/T]gctgcaggaaattattttagaact
- ASB in cell types
- foreskin keratinocyte erythroid cells HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.50 | 2.33 | |||
| erythroid cells | -2.29 | 2.07 | 1.50 | |||
| HUES64 (embryonic stem cells) | 1.81 | -1.46 | 1.33 |
Items per page:
1 – 3 of 3