rs9523746 chr13:92644306 T>A
- Sequence
ctgctagctttagaaacaaatatc[T/A]aataggatctattttgacactgca
- ASB in cell types
- VCaP (prostate carcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.20 | 1.28 | 2.45 | |||
| LNCaP (prostate carcinoma) | 0.73 | 0.06 | 1.62 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), mitral annular calcium, obesity with early age of onset (age >2), waist hip ratio