rs9558552 chr13:105443089 G>A
- Sequence
cctctccatagcaacataacattg[G/A]tattaactcaagcttgatgatcac
- ASB in cell types
- HT29 (colon adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT29 (colon adenocarcinoma) | -2.33 | 1.47 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hip bone mineral density (bmd), ldl cholesterol, sporadic creutzfeldt-jakob disease, total cholesterol, years of education