rs9572927 chr13:72256069 G>A
- Sequence
atgaccttgcaccaaggtggtagg[G/A]ccctaagatcctctgctgtaggct
- ASB in cell types
- foreskin keratinocyte 22RV1 (prostate carcinoma) liver
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.41 | 0.01 | 1.48 | n/a | No Hit | |||
| RAD21_HUMAN | 1.66 | -0.03 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, obesity with early age of onset (age >2), suicide attempts in bipolar disorder (females)