rs9585062 chr13:99442586 A>C
- Sequence
ttaaattcatattgtctttagaat[A/C]ttatgtgatcagaatatggaaata
- ASB in cell types
- foreskin keratinocyte B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.51 | n/a | 2.50 | |||
| B-cells | 1.73 | n/a | 2.00 |
Items per page:
1 – 2 of 2