rs9591145 chr13:32587322 G>T
- Sequence
gtggtccccgagcagccagttgag[G/T]aagagcccagcactggcgtggagg
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- CTCF_HUMAN ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.52 | 0.35 | 1.41 | -3.59 | Concordant | |||
| ELF1_HUMAN | 1.94 | -1.75 | 1.33 | -5.01 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid