rs9603697 chr13:40209186 C>T
- Sequence
ccattaaagcaagggggattcata[C/T]ctgacaactaggggcacattcatc
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 1.45 | -1.48 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, body mass index (bmi), chronic kidney disease, fasting blood glucose, ldl cholesterol change with statins, lp-pla2 mass, spine bone mineral density (bmd), total cholesterol change with statins, variant creutzfeldt-jakob disease