rs9623117 chr22:40056115 T>C
- Sequence
tctccctgttactcttaagtagtg[T/C]ctcctttccccatccaccccatct
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.47 | -0.11 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aggressive prostate cancer, bipolar disorder, hip bone mineral density (bmd), non-aggressive prostate cancer, paternal transmission distortion, prostate cancer (advanced prostate cancer), transmission distortion
PheWAS abnormal findings on study of brain, nervous system, acquired absence of breast, acute laryngitis and tracheitis, adrenal hypofunction, adverse effects of antibacterials (not penicillins), aphasia/speech disturbance, atrial flutter, balanoposthitis, blood vessel replaced, cerebral ischemia, chronic airway obstruction, chronic kidney disease, stage i or ii, complications of gastrostomy, colostomy and enterostomy, diplopia and disorders of binocular vision, disorders of adrenal glands, elevated c-reactive protein, elevated prostate specific antigen, elevated sedimentation rate, essential tremor, fasciitis, fracture of ankle and foot, fracture of foot, gangrene, heart failure nos, hemiplegia, hyperbilirubinemia, hyperplasia of prostate, injuries to the nervous system, iron deficiency anemia secondary to blood loss, keratitis, infectious, known or suspected fetal abnormality, late effects of cerebrovascular disease, melanoma, mucous polyp of cervix, other conditions of the mother complicating pregnancy, other disorders of prostate, peripheral enthesopathies, phlebitis and thrombophlebitis, phlebitis and thrombophlebitis of lower extremities, phobia, pleurisy, pleural effusion, polymyalgia rheumatica, polyp of female genital organs, postoperative infection, posttraumatic stress disorder, prostate cancer, pseudomonal pneumonia, ptosis of eyelid, pulmonary collapse, interstitial/compensatory emphysema, rash and other nonspecific skin eruption, scar conditions and fibrosis of skin, secondary thrombocytopenia, spondylosis without myelopathy, stress incontinence, female, subdural hemorrhage (injury), symptoms affecting skin, transient cerebral ischemia, viral pneumonia