rs963460 chr10:112721311 G>A
- Sequence
gagcactcacttaccattgccata[G/A]ttaacagttatttagcaacgctac
- ASB in cell types
- KMS-11 erythroid progenitors foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 | -2.16 | 2.36 | 2.00 | |||
| erythroid progenitors | 1.98 | -1.66 | 2.00 | |||
| foreskin keratinocyte | 0.76 | n/a | 2.67 |
Items per page:
1 – 3 of 3