rs9644050 chr8:28072993 T>C
- Sequence
ctgagctgagatgcggtttcattg[T/C]tgactgttgaaatttttttttttt
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.68 | -0.81 | 1.33 | n/a | n/a | |||
| FOXA2_HUMAN | 1.78 | -1.68 | 1.33 | -4.19 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP body mass index (bmi), total cholesterol change with statins, urinary albumin-to-creatinine ratio