rs9651181 chr1:151541037 C>A
- Sequence
ggatagggctttccgcccgggggt[C/A]acctcttgtcttggatttctcctt
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.81 | -0.10 | 2.02 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.45 | 0.98 | 2.50 |
Items per page:
1 – 2 of 2