rs965215 chr17:57624197 A>G
- Sequence
cctccctgagggaaggtgacacat[A/G]ggcttatgcttttgctgtcagatt
- ASB in cell types
- CLB-Ga (neuroblastoma)
- ASB for transcription factors
- HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HAND2_HUMAN | n/a | 2.36 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), ldl cholesterol change with statins, refractive error, simpson-angus scale, total cholesterol change with statins