rs9655055 chr7:47568968 G>A
- Sequence
aacaaagcccacagtattcacagc[G/A]tggctgccatcaccacacccactc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts Human Umbilical Cord Blood-Derived Erythroid Progenitor Cells-2 (HUDEP-2)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells-derived proerythroblasts | 0.30 | 1.43 | 2.00 | |||
| Human Umbilical Cord Blood-Derived Erythroid Progenitor Cells-2 (HUDEP-2) | 1.33 | -0.72 | 1.50 |
Items per page:
1 – 2 of 2