rs9656461 chr7:135800044 T>C
- Sequence
ttataaaaggacagcaatagcgcc[T/C]cctttacagagttgctgtgagggt
- ASB in cell types
- SK-N-SH (neuroblastoma) K562 (myelogenous leukemia)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.53 | 1.28 | 1.80 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, obesity with early age of onset (age >2), prop taste detection threshold, urinary albumin-to-creatinine ratio