rs9668141 chr12:8396789 C>G
- Sequence
ggcggcgcgggctcctccgcgggc[C/G]gctcgtggtcctctggcgccctct
- ASB in cell types
- spleen upper lobe of left lung neural cell IPSC-derived bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.82 | 0.11 | 1.18 | n/a | No Hit | |||
| SMC3_HUMAN | 0.78 | -0.78 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Frontal_Cortex_BA9, Colon_Transverse, Lung, Nerve_Tibial, Pituitary, Spleen, Testis, Whole_Blood