rs969715 chr9:28820809 A>G
- Sequence
tggctaatagagctgtgaatattc[A/G]gtgaaggccaataatcaatttgct
- ASB in cell types
- GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23338 | -1.60 | 1.84 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP appendicular lean mass-femoral neck buckling ratio bivariate association, appendicular lean mass-femoral neck cortical thickness bivariate association, appendicular lean mass-femoral neck cross-sectional area bivariate association, appendicular lean mass-femoral neck periosteal diameter bivariate association, fasting blood glucose, salmonella-induced pyroptosis, simpson-angus scale, tardive dyskinesia