rs9701027 chr1:229135164 C>T
- Sequence
ctaaactccagaatggtagatcca[C/T]ctattgcttaggctgtgcacctgg
- ASB in cell types
- HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | 1.59 | -0.92 | 2.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi) (within family tests max measurement), cystatin c in serum, dental caries, microalbuminuria