rs970482 chr12:1804696 T>C
- Sequence
ccaatggaatgtgagcagagccgc[T/C]gggagggacttccgggaagcgggc
- ASB in cell types
- liver
- ASB for transcription factors
- GABPA_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | 1.55 | 0.50 | 1.42 | n/a | No Hit | |||
| ZFX_HUMAN | 0.06 | 1.30 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), systolic blood pressure (sbp), urinary albumin-to-creatinine ratio