rs9729152 chr1:99776207 C>T
- Sequence
gctgccattcccacacttgagcag[C/T]catcattaattacttgcaatgccc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.13 | 0.79 | 1.75 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Whole_Blood