rs9785050 chr7:25259786 A>T
- Sequence
aaaaattgctgccctagaagcgag[A/T]ggaaggcgtcctggtgtgtaaaag
- ASB in cell types
- HeLa Kyoto (cervical adenocarcinoma) liver transverse colon GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa Kyoto (cervical adenocarcinoma) | 1.29 | -0.90 | 2.00 | |||
| liver | 2.22 | n/a | 2.00 | |||
| transverse colon | -0.15 | 0.90 | 1.00 | |||
| GM12878 (female B-cells) | 0.52 | 0.33 | 1.33 | |||
| tibial artery | -1.65 | 1.45 | 1.33 |
Items per page:
1 – 5 of 9
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, fasting blood glucose, homa-ir, obesity with early age of onset (age >2)