Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs9792437 chr9:121202623 A>G

Sequence
gtttcgtgcttttcgggtgcaggg[A/G]cacgttttgactttcttggaccct
ASB in cell types
GM12878 (female B-cells)

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (G) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
GM12878 (female B-cells) 0.60 0.40 0.020.74 1.26
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

GRASP advanced age-related macular degeneration advanced age-related macular degeneration (choroidal neovascularization) vs. no amd fasting blood glucose hiv-1 disease progression ldl cholesterol change with statins lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in asthmatic participants) major depressive disorder (citalopram treatment remission) major depressive disorder (citalopram treatment response) rheumatoid arthritis total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Coronary Artery_Tibial Brain_Amygdala Brain_Anterior_cingulate_cortex_BA24 Brain_Caudate_basal_ganglia Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Cortex Brain_Frontal_Cortex_BA9 Brain_Hippocampus Brain_Hypothalamus Brain_Nucleus_accumbens_basal_ganglia Brain_Putamen_basal_ganglia Brain_Spinal_cord_cervical_c-1 Brain_Substantia_nigra Breast_Mammary_Tissue Cells_Cultured_fibroblasts Cells_EBV-transformed_lymphocytes Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Liver Lung Minor_Salivary_Gland Muscle_Skeletal Nerve_Tibial Ovary Pancreas Pituitary Prostate Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Spleen Stomach Testis Thyroid Uterus Vagina Whole_Blood

Download