rs9801882 chr8:142520096 T>G
- Sequence
gatggtggtgatggctgtgttggt[T/G]atggtgatagtggtaatgattgta
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.06 | 0.65 | 1.72 | |||
| HEK293 (embryonic kidney) | 0.50 | 0.08 | 1.50 |
Items per page:
1 – 2 of 2