rs9812611 chr3:198080324 G>A
- Sequence
gctgagcccccgctacctgtcctg[G/A]gcatccacgtcccggcacctgcgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.14 | 0.95 | 1.83 | |||
| HEK293 (embryonic kidney) | 0.73 | 0.33 | 1.51 | |||
| foreskin keratinocyte | 1.65 | -2.41 | 2.33 |
Items per page:
1 – 3 of 3