rs9848177 chr3:98185413 G>A
- Sequence
cttggaagaacagcttgtccttgt[G/A]ttgtttagtttgcagcaccatctg
- ASB in cell types
- VCaP (prostate carcinoma) RWPE2 HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.08 | 1.08 | 2.00 | |||
| RWPE2 | 1.66 | -1.72 | 1.00 | |||
| HEK293 (embryonic kidney) | -0.87 | 1.16 | 1.42 |
Items per page:
1 – 3 of 3