rs9866710 chr3:33980494 G>A
- Sequence
gctgctgcccagcatctcccttac[G/A]ctagatggagctaccattccatta
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte T47D (invasive ductal carcinoma) thoracic aorta
- ASB for transcription factors
- SCRT2_HUMAN CTCF_HUMAN SCRT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SCRT2_HUMAN | n/a | 3.63 | 2.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.68 | 1.20 | 1.40 | 1.13 | Weak Concordant | |||
| SCRT1_HUMAN | -3.01 | 2.42 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol change with statins, microalbuminuria, total cholesterol change with statins, triglycerides, waist height ratio squared