rs9880109 chr3:8623052 A>G
- Sequence
gctgcagcagcagcagaaggggct[A/G]ctcagggctgctcctggggatgta
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte GM12878 (female B-cells)
- ASB for transcription factors
- RAD21_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.81 | -1.46 | 1.33 | n/a | n/a | |||
| FOXK2_HUMAN | 1.78 | -1.95 | 1.92 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP asthma, college completion, ldl cholesterol, maternal transmission distortion, obesity with early age of onset (age >2), transmission distortion, triglycerides, years of education