rs9898312 chr17:78317528 G>C
- Sequence
gtgtgcacgtgtgtgagtgtgtac[G/C]tgtttataggagcatgactgcctg
- ASB in cell types
- GM12878 (female B-cells) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.63 | 0.30 | 1.28 | |||
| A549 (lung carcinoma) | -0.47 | 0.78 | 2.84 |
Items per page:
1 – 2 of 2