rs9900387 chr17:78168323 A>C
- Sequence
gggcaaagagggtgagcggtcctc[A/C]gttcgtccgtcttcccgggggact
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) HEK293 (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.91 | -0.16 | 2.00 | |||
| GM12878 (female B-cells) | 0.48 | 0.60 | 1.28 | |||
| HEK293 (embryonic kidney) | 0.67 | 0.89 | 1.70 | |||
| A549 (lung carcinoma) | 1.08 | -0.52 | 3.00 | |||
| upper lobe of left lung | 0.12 | 1.54 | 1.11 |
Items per page:
1 – 5 of 5