rs9909570 chr17:78162446 G>A
- Sequence
tatggggtatgggaaccaggaagt[G/A]ttgcccgacttagggtgggacaag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.93 | -0.26 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, fasting blood glucose, total cholesterol, triglycerides, type 1 diabetes, combined control dataset, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Esophagus_Muscularis, Liver, Nerve_Tibial, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid