rs9916043 chr17:57735899 C>T
- Sequence
gagtgttgggatcgatgactgatg[C/T]ctgccacctgtggagggctccagg
- ASB in cell types
- foreskin keratinocyte HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 2.41 | 2.50 | |||
| HCT-116 (colon carcinoma) | -0.50 | 0.94 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP circulating sex hormone-binding globulin levels in non-postmenopausal hormone users, fasting insulin