rs9928594 chr16:80536344 T>C
- Sequence
aaggctgtagaccaaaagaaatta[T/C]cttgcactacagtgtgaggtacac
- ASB in cell types
- CD34+ bone marrow cell-derived erythroid progenitors
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.74 | n/a | 1.94 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting insulin, susceptibility to cytomegalovirus infection, triglycerides change with statins