rs994177 chr8:69186447 T>C
- Sequence
agttcacccttttctccacagcct[T/C]gccaacatctgttattttttgact
- ASB in cell types
- HEK293 (embryonic kidney) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.05 | 0.21 | 1.38 | |||
| SK-N-SH (neuroblastoma) | 0.88 | -0.01 | 1.33 |
Items per page:
1 – 2 of 2