rs9943081 chr1:226350353 C>A
- Sequence
ctccgcaggccgctgctcccttat[C/A]ttcagtcagccggcaggtttcctg
- ASB in cell types
- Kasumi-1 (childhood acute myeloid leukemia with maturation)
- ASB for transcription factors
- TFE2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TFE2_HUMAN | 2.03 | -1.96 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1