rs9958947 chr18:49560562 C>T
- Sequence
gagacagagtgggaacaacatatc[C/T]gggggtgatatttaccatcgcaca
- ASB in cell types
- HEK293 (embryonic kidney) GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.14 | -0.52 | 2.38 | |||
| GM23248 | -1.09 | 1.31 | 1.00 |
Items per page:
1 – 2 of 2