rs99595 chr20:57414752 C>T
- Sequence
gacggacccatgctgccaatccaa[C/T]aagacaaaccctcctgcttcagtc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.89 | -0.16 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, chronic kidney disease, cystatin c in serum, hdl cholesterol change with statins, infant head circumference, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), mean corpuscular volume (mcv) among heterozygotes for b-thalassemia, red blood cell count (rbc), serum creatinine, simpson-angus scale, triglycerides